More Related Content
Similar to Genetic_Testing_PowerPoint_12-09.ppt (20)
Recently uploaded (20)
Genetic_Testing_PowerPoint_12-09.ppt
- 1. Genetic Testing Family Secrets Copyright 息 2009, University of Rochester
- 2. Genetic disease and testing The patients journey Types of genetic tests Techniques used in genetic testing Implications of genetic testing The future
- 4. Inherited disease x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23 x23
- 6. Symptoms
- 7. ?
- 8. Predictive testing Tells a person if she carries a mutation that will cause, or put her at higher risk for, a disease later in life. Newborn screening Detects common disorders in newborns, where immediate treatment can prevent dangerous symptoms Carrier testing Tells a person whether or not he carries a mutation that could be passed on to his offspring. One can be a carrier, but not be at risk for a disease (as in recessive genes) ? ? ? ? Genetic Testing
- 9. Predictive testing Tells a person if she carries a mutation that will cause, or put her at higher risk for, a disease later in life. Newborn screening Detects common disorders in newborns, where immediate treatment can prevent dangerous symptoms Carrier testing Tells a person whether or not he carries a mutation that could be passed on to his offspring. One can be a carrier, but not be at risk for a disease (as in recessive genes) ? ? ? ? Genetic Testing
- 15. DNA Protein Protein Function Levels of Genetic Testing normal mutated Analysis of whole chromosomes for large changes; extra chromosome, very large deletions or insertions atcgatcgatcg atcgaAcgatcg Analysis of sequence for small changes; mutations in the sequence, small deletions or insertions Analysis of protein shape for any change that may affect the folding of the protein Analysis of protein function if the functional protein is supposed to make something, then some tests can detect the presence or absence of the product X X
- 16. DNA Protein Protein Function normal mutated Analysis of whole chromosomes for large changes; extra chromosome, very large deletions or insertions atcgatcgatcg atcgaAcgatcg Analysis of sequence for small changes; mutations in the sequence, small deletions or insertions Analysis of protein shape for any change that may affect the folding of the protein Analysis of protein function if the functional protein is supposed to make something, then some tests can detect the presence or absence of the product X X Levels of Genetic Testing
- 17. Examples of Mutations in the DNA Sequence
- 25. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Dot blot Microarray Gel electrophoresis PCR
- 26. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Dot blot Microarray Gel electrophoresis PCR
- 27. Gel Electrophoresis Separates DNA fragments on the basis of size Large fragments take longer than small fragments to migrate through an agarose gel
- 29. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Southern blot Dot blot Microarray Gel electrophoresis PCR
- 30. PCR (Polymerase Chain Reaction) aatcgaatgtgcccgtacgattcgatgcgaaactaggagccctatcgat ttagcttacacgggcatgctaagctacgctttgatcctcgggatagcta
- 37. PCR Makes a lot of copies of a specific portion of DNA
- 38. PCR test for deletion Electrophoresis
- 39. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Southern blot Dot blot Microarray PCR Gel electrophoresis
- 40. Sequencing aaaaaaaatgatgatgatgatgatgatgatgatgatgatgatg Known gene sequence: *** Patient DNA sequence How do we find out if the patients sequence is different?
- 46. Sequencing *** tttttttta* *** *** *** *** ttttttttactac* ttttttttact* ttttttttac* ttttttttacta* a
- 47. Sequencing *** tttttttta* *** *** *** *** ttttttttactac* ttttttttact* ttttttttac* ttttttttacta* a c
- 53. Issues with Sequencing Informative Time consuming Expensive
- 54. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Southern blot Dot blot Microarray PCR Gel electrophoresis
- 55. RFLP Analysis RFLP (Restriction Fragment Length Polymorphism) analysis relies on the use of restriction enzymes These enzymes recognize specific DNA sequences (usually palindromes) and cut them
- 56. RFLP Analysis Restriction Fragment Length Polymorphism means that there are polymorphisms (differences) between people in the number of restriction sites (and therefore the length of the cut fragments). This person has 4 fragments after restriction digest. This person has a mutation that eliminates one of the sites that the restriction enzyme cuts at. Therefore, this person has 3 bands, one of them being much larger than the rest. If this mutation was associated with a disease, a restriction digest would show that a carrier of the mutation had 3 fragments instead of 4
- 57. RFLP Analysis
- 58. RFLP Analysis Genomic DNA is very long and contains a lot of restriction enzyme cut sites PCR makes many copies of a small region of DNA, better for RFLP analysis
- 59. RFLP Analysis
- 60. RFLP Analysis
- 61. RFLP Analysis
- 62. Issues with RFLP analysis Can not detect all mutations the mutation has to coincide with a restriction enzyme cut site
- 63. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Dot blot Microarray PCR Gel electrophoresis
- 64. Probes DNA bases pair with complementary bases
- 65. Probes Probe A probe is an a short fragment of DNA that is complementary to part of a longer DNA sequence. DNA strands can be separated with high heat. As the temperature is lowered, smaller fragments that have complementary sequences (probes) will base pair faster than the long original strands of DNA
- 66. Probes The ability of a probe to bind depends on: *Its complementarity to the DNA strand its binding to -Single base pair differences can affect binding depending on *The stringency of the binding conditions -Temperature -Buffer conditions Low stringency High stringency
- 67. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Dot blot Microarray PCR Gel electrophoresis
- 68. Dot Blot (A Southern blot without the gel) A patients DNA (genomic DNA or PCR products) is denatured and spotted to a membrane
- 69. Dot Blot Membrane is washed in a solution that contains radioactively labeled probe Probe binds to complementary sequence
- 70. Dot Blot Membrane is washed in a solution that contains radioactively labeled probe Excess probe is washed off only probe bound to DNA on the membrane remains Probe binds to complementary sequence
- 71. Dot Blot The membrane is exposed to autoradiography film.. Therefore, wherever there is radioactive probe, the film will be exposed
- 72. Dot Blot The membrane is exposed to autoradiography film.. Therefore, wherever there is radioactive probe, the film will be exposed And a black dot will be developed where the probe was
- 73. Dot blot to diagnose cystic fibrosis (CF) Normal Normal probe Mutant probe CF patient (homozygous mutant) CF carrier (heterozygous mutant) DNA from a patient is spotted out twice, one will be used with a probe complementary to the normal sequence, the other will be used with a probe that is complementary to a mutated sequence. Since a heterozygote has one copy of the normal gene and one copy of the abnormal gene, both probes can bind, but only half as much binds, making the dot lighter.
- 74. Issues with dot blots Can be used to test patient for multiple mutations Single base pair mutations may be hard to detect with dot blots
- 75. How do we look at the DNA sequence? Sequencing RFLP analysis Probes Dot blot Microarray PCR Gel electrophoresis
- 76. Microarray (High throughput dot blots. Allows for testing of many different mutations) Microarrays start with a chip on which is spotted many different probes for different mutations. Each dot represents a different probe. If this were a dot blot, it would be called a reverse dot blot because the PROBE is spotted, rather than the DNA.
- 77. Microarray (High throughput dot blots. Allows for testing of many different mutations) The chip is treated much like a southern or a dot blot, except it is washed with a patients DNA (fragmented with restriction enzymes, denatured and labeled with a flourescent dye), and it automated.
- 78. Microarray Binds to a probe for a CF mutation Binds to a probe for a colon-cancer susceptibility mutation Binds to a probe for a breast-cancer susceptibility mutation If a patients DNA binds to spotted probes, a computer detects this by the measuring the intensity of the flourescence emanating from that spot. A homozygote for a CF mutation will have a more intense spot than a heterozygote for the same mutation
- 79. Issues with Microarrays Expensive
- 80. Available Predictive Tests Cystic Fibrosis Tay Sachs Disease Lou Gherigs Disease (ALS) Huntingtons Disease Catastrophically high cholesterol Rare Cancers Inherited susceptibilty to cancer Breast Cancer Colon Cancer Thyroid Cancer
- 81. Benefits of Genetic Testing If Negative Relief Fewer health check- ups and tests that go with being in a family that tends to have a higher risk of a particular genetic diseases If Positive Able to make informed decisions May be possible to reduce the risk of coming down with severe symptoms
- 82. Limitations of Genetic Testing Mutations may not always lead to disease Existing tests only look for the most common mutations, some disease causing mutations will not be detected by conventional tests Small chance of errors in testing procedure Testing is not always matched by treatment
- 83. Limitations of Genetic Testing Mutations may not always lead to disease Existing tests only look for the most common mutations, some disease causing mutations will not be detected by conventional tests Small chance of errors in testing procedure Testing is not always matched by treatment
- 84. Should I get tested? What will I do if its positive? What will we do if hes positive? Testing is not always matched by treatment: Confidentiality Health Insurance Employers Family
- 85. Where do we go now? Try to resolve ethical, legal and social issues Experts in science, ethics, law. Policy makers Develop new, cheap, simple, effective and accurate tests Testing for all Advance research in disease treatment Gene therapy Drug treatment