Python lec 1004_ch02_excercies
Download as PPTX, PDF1 like735 views
This document discusses three Python programming exercises for biologists: 1) Write a program to calculate the AT content of a given DNA sequence. 2) Write a program to print the complement of a given DNA sequence by replacing nucleotides. 3) Write a program to calculate the lengths of two fragments produced when a given DNA sequence is digested with the EcoRI restriction enzyme.
1 of 10
Download to read offline
Recommended
Solucionario semana 2Rodolfo Carrillo Velsquez
油
El documento presenta 16 problemas de trigonometr鱈a resueltos por el Lic. Rodolfo Carrillo Vel叩squez. Los problemas involucran c叩lculos de 叩ngulos, longitudes de arcos, 叩reas de sectores circulares y n炭meros de vueltas de ruedas. El Lic. Carrillo proporciona las soluciones paso a paso usando f坦rmulas trigonom辿tricas b叩sicas como seno, coseno y tangente.Alphafold2 - Protein Structural Bioinformatics After CASP14
Alphafold2 - Protein Structural Bioinformatics After CASP14Purdue University
油
This presentation discusses Alphafold2 about the algorithm in comparison with others and the time course of the impact and development that happened after the paper and software release. This slide was presented at IIBMP2021 https://iibmp2021.hamadalab.com/program/, a virtual conference in Tokyo, Japan on 9/27, 28, 2021Clustering
ClusteringRashmi Bhat
油
This document provides information about clustering and cluster analysis. It begins by defining clustering as the process of grouping objects into classes of similar objects. It then discusses what a cluster is and different types of clustering techniques, including partitioning methods like k-means clustering. K-means clustering is explained as an algorithm that assigns objects to clusters based on minimizing distance between objects and cluster centers, then updating the cluster centers. Examples are provided to demonstrate how k-means clustering works on a sample dataset.Reinforcement learning slides
Reinforcement learning slidesOmranHakami
油
Reinforcement learning is one type of machine learning that focuses on finding optimal actions through trial-and-error interactions with an environment. It involves an agent taking actions in an environment, receiving rewards or punishments, and learning a policy that maps states to actions to maximize rewards over time. The document provides an overview of reinforcement learning concepts like the agent, environment, policy, rewards, and observations. It also discusses when reinforcement learning should and should not be used compared to other machine learning methods.missing-data-and-multiple-imputation-in-clinical-epidemiolog 
missing-data-and-multiple-imputation-in-clinical-epidemiolog simbycris
油
This document discusses methods for dealing with missing data in clinical epidemiological research. It begins by explaining the different types of missing data: missing completely at random (MCAR), missing at random (MAR), and missing not at random (MNAR). Missing data is rarely MCAR in clinical studies and can weaken study results if not addressed properly. The document then reviews traditional methods like complete case analysis and introduces multiple imputation as an alternative method that accounts for uncertainty in missing data under the MAR assumption. Multiple imputation provides valid estimates based on available data and should be considered over traditional approaches.R programming presentation
R programming presentationAkshat Sharma
油
The R language is a project designed to create a free, open source language which can be used as a replacement for the S-PLUS language, originally developed as the S language at AT&T Bell Labs, and currently marketed by Insightful Corporation of Seattle, Washington. R is an open source implementation of S, and differs from S-plus largely in its command-line only format.
Topics Covered:
1.Introduction to R
2.Installing R
3.Why Learn R
4.The R Console
5.Basic Arithmetic and Objects
6.Program Example
7.Programming with Big Data in R
8.Big Data Strategies in R
9.Applications of R Programming
10.Companies Using R
11.What R is not so good at
12.ConclusionData Visualization using different python libraries.pptx
Data Visualization using different python libraries.pptxHamzaAli998966
油
This document discusses data visualization using Python libraries like Pandas, NumPy, and Matplotlib. It covers various types of charts that can be created like line charts, bar charts, and histograms to visualize different aspects of stock market data. Descriptive statistics are calculated on the stock data and various visualizations are created to analyze trends in closing prices, moving averages, daily returns, and correlations between stocks. Finally, it discusses predicting future closing stock prices of Apple using an LSTM model.Final Presentation-Delta
Final Presentation-DeltaAnna Blendermann
油
This document describes Anna Blendermann's development of a bioinformatics pipeline for forensic STR data analysis. The pipeline involves (1) STR analysis and profiling of DNA samples, (2) next generation sequencing to determine nucleotide sequences, and (3) bioinformatics processing including a Java program to convert sequences into condensed bracket notation highlighting allele lengths and repeats. This bracket notation output provides a more user-friendly view of the genetic data compared to the raw output. Anna plans to make this program available on an open web platform called Galaxy to facilitate genetics research.rnaseq_from_babelomics
rnaseq_from_babelomicsFrancisco Garc
油
This document discusses RNA-Seq data analysis using Babelomics 5 software. It describes the typical RNA-Seq data analysis pipeline which includes sequence preprocessing, mapping, quantification, normalization, differential expression analysis, and functional profiling. It also discusses common file formats used like Fastq, BAM, and count matrices. Normalization methods like RPKM and TMM are explained. The document provides an overview of the RNA-Seq data analysis capabilities in Babelomics 5.An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...
An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...IOSR Journals
油
This document presents two improved biological sequence compression algorithms that utilize a lookup table (LUT) and identification of tandem repeats in sequences. The first algorithm maps all possible 3-character combinations to ASCII characters using a 125-entry LUT. The second maps all possible 4-character combinations to ASCII characters using a 256-entry LUT. These algorithms aim to achieve high compression factors, saving percentages, and faster compression/decompression times compared to previous biological sequence compression methods.From DNA Sequence Variation to .NET Bits and Bobs
From DNA Sequence Variation to .NET Bits and BobsSource Conference
油
Mathieu Letourneau, Andrei Saygo, Eoin Ward, Microsoft
This talk will present our research project on .Net file clustering based on their respective basic blocks and the parallel that can be made with DNA sequence variation analysis. We implemented a system that extracts the basic blocks on each file and creates clusters based on them. We also developed an IDA plugin to make use of that data and speed up our analysis of .Net files.
Andrei Saygo, Eoin Ward and Mathieu Letourneau all work as Anti-Malware Security Engineers in the AM Scan team of Microsofts Product Release & Security Services group in Dublin, Ireland.
CCC-Bicluster Analysis for Time Series Gene Expression Data
CCC-Bicluster Analysis for Time Series Gene Expression DataIRJET Journal
油
The document presents a CCC-Biclustering (Contiguous Column Coherence) algorithm for identifying biclusters in time series gene expression data. The algorithm finds maximal biclusters with adjacent/contiguous columns in linear time using Ukkonen's suffix tree construction algorithm and discretized gene expression matrices. The algorithm was applied to a Saccharomyces cerevisiae gene expression time series in response to heat stress. It identifies coherent expression patterns shared among genes over contiguous time points, potentially revealing relevant regulatory modules.MuVM: Higher Order Mutation Analysis Virtual Machine for C
MuVM: Higher Order Mutation Analysis Virtual Machine for CSusumu Tokumoto
油
Mutation analysis is a method for evaluating the effectiveness of a test suite by seeding faults artificially and measuring the fraction of seeded faults detected by the test suite. The major limitation of mutation analysis is its lengthy execution time because it involves generating, compiling and running large numbers of mutated programs, called mutants. Our tool MuVM achieves a significant runtime improvement by performing higher order mutation analysis using four techniques, metamutation, mutation on virtual machine, higher order split-stream execution, and online adaptation technique. In order to obtain the same behavior as mutating the source code directly, metamutation preserves the mutation location information which may potentially be lost during bitcode compilation and optimization. Mutation on a virtual machine reduces the compilation and testing cost by compiling a program once and invoking a process once. Higher order split-stream execution also reduces the testing cost by executing common parts of the mutants together and splitting the execution at a seeded fault. Online adaptation technique reduces the number of generated mutants by omitting infeasible mutants. Our comparative experiments indicate that our tool is significantly superior to an existing tool, an existing technique (mutation schema generation), and no-split-stream execution in higher order mutation.DSP_Assign_1
DSP_Assign_1Joseph Chandler
油
This document summarizes four problems completed in a lab using a Tiva C Series microcontroller. Problem 1 introduced the microcontroller and Code Composer Studio software. Problem 2 described header files used in the code. Problem 3 explored adjusting clock speeds. Problem 4 provided an overview of the microcontroller platform, peripheral drivers library, and GPIO module. The code caused three LEDs to blink by writing pin values using delays timed based on clock speed.Towards reading genomic data using deep learning-driven NLP techniques
Towards reading genomic data using deep learning-driven NLP techniquesWesley De Neve
油
Towards reading genomic data using deep learning-driven NLP techniques. 際際滷s presented at BIOINFO 2016 Precision Bioinformatics & Machine Learning.1_chlamydia task completely best.docx
1_chlamydia task completely best.docxRachaelMutheu
油
This study sequenced and analyzed the genome of Chlamydia trachomatis. Quality control was performed on sequencing reads. The reads were then assembled using SPAdes and evaluated for quality. The assembled contigs were annotated using Prokka. Reads were aligned to the assembly using Bowtie2 and counted using HTSeq to quantify gene expression. Differential expression analysis was performed using DESeq2 to compare gene expression at different time points of infection. Various plots were generated to visualize the data.Pragmatic Optimization in Modern Programming - Demystifying the Compiler
Pragmatic Optimization in Modern Programming - Demystifying the CompilerMarina Kolpakova
油
This document discusses compiler optimizations. It begins with an outline of topics including compilation trajectory, intermediate languages, optimization levels, and optimization techniques. It then provides more details on each phase of compilation, how compilers use intermediate representations to perform optimizations, and specific optimizations like common subexpression elimination, constant propagation, and instruction scheduling.Gemoda
GemodaKyle Jensen
油
The document describes the Gemoda algorithm for discovering motifs (patterns) in biomolecular data sequences. Gemoda is designed to be exhaustive in finding all maximal motifs and have descriptive power by using a generic, context-dependent definition of similarity. It proceeds in three steps: comparison of all pairwise windows to create a similarity graph, clustering similar windows into elementary motifs, and convolving the motifs to find longer, maximal motifs. Gemoda can be applied to problems like discovering protein domains, solving motif discovery challenges, and finding conserved structures in protein structures.
Comparative analysis of dynamic programming algorithms to find similarity in ...
Comparative analysis of dynamic programming algorithms to find similarity in ...eSAT Journals
油
Abstract There exist many computational methods for finding similarity in gene sequence, finding suitable methods that gives optimal similarity is difficult task. Objective of this project is to find an appropriate method to compute similarity in gene/protein sequence, both within the families and across the families. Many dynamic programming algorithms like Levenshtein edit distance; Longest Common Subsequence and Smith-waterman have used dynamic programming approach to find similarities between two sequences. But none of the method mentioned above have used real benchmark data sets. They have only used dynamic programming algorithms for synthetic data. We proposed a new method to compute similarity. The performance of the proposed algorithm is evaluated using number of data sets from various families, and similarity value is calculated both within the family and across the families. A comparative analysis and time complexity of the proposed method reveal that Smith-waterman approach is appropriate method when gene/protein sequence belongs to same family and Longest Common Subsequence is best suited when sequence belong to two different families. Keywords - Bioinformatics, Gene, Gene Sequencing, Edit distance, String Similarity.Comparative analysis of dynamic programming
Comparative analysis of dynamic programmingeSAT Publishing House
油
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology.Lossless Data Compression Using Rice Algorithm Based On Curve Fitting Technique
Lossless Data Compression Using Rice Algorithm Based On Curve Fitting TechniqueIRJET Journal
油
This document describes a lossless data compression technique called the Rice algorithm and a modification of the Rice algorithm using curve fitting. The Rice algorithm uses a two-stage approach of preprocessing data to decorrelate it followed by entropy coding to assign variable-length codes. The modified Rice algorithm uses curve fitting to generate a function to predict future data points for improved compression performance compared to the original Rice algorithm. Simulation results show the modified algorithm achieves better compression by selecting an encoding option that uses fewer bits than the original Rice algorithm on a sample data set.Gas leakage detection system
Gas leakage detection systemAashiq Ahamed N
油
The main aim of this project is to avoid the accident and death in the gas leakage explosion in house, hotels and industries. Domestically we use natural gas and it is very useful for burning purpose. If this gas is leaked in our kitchens, hotels or factories and not sensed in time, it may lead to fatal disaster, and may cause human and material loss. For this purpose we have developed GAS LEAKAGE DETECTION SYSTEM.
ECG BASED REPORT.
ECG BASED REPORT.Mehran University Of Engineering And Technology Jamshoro.
油
The document describes an algorithm for detecting R-peaks in an electrocardiogram (ECG) signal using MATLAB. It involves several steps: (1) removing low frequency components from the ECG signal using FFT, (2) finding local maxima using a windowed filter, (3) removing small values and storing significant peaks, (4) adjusting the filter size and repeating steps 2-3. The algorithm is demonstrated on two ECG data samples, showing the processed signal and detected peaks at each step. Finally, the document explains how to implement the algorithm in a neural network using the MATLAB Neural Network Toolbox.DNA Compression (Encoded using Huffman Encoding Method)
DNA Compression (Encoded using Huffman Encoding Method)Marwa Al-Rikaby
油
The document discusses DNA compression algorithms. It describes the common components of most DNA compression algorithms, which include finding repeat segments in a DNA sequence, considering approximate repeats allowing for operations like substitutions, and selecting the best set of compatible repeats. It then provides an example demonstrating how these steps may be applied to a sample DNA sequence to identify repeat segments and encode them for compression.BLAST_CSS2.ppt
BLAST_CSS2.pptSilpa87
油
This document provides an overview of the BLAST algorithm for calculating sequence similarity and its various outputs. BLAST (Basic Local Alignment Search Tool) finds local alignments between biological sequences and produces outputs in various formats including pairwise alignments, hit tables, and structured outputs like ASN.1 and XML. It works by creating a lookup table of words from the query and scanning the database for matches to initiate gapped or ungapped extensions. The document discusses strategies for improving BLAST throughput, such as using MegaBLAST for very similar sequences, increasing word size thresholds, and concatenating queries to minimize database scanning.2007 Tidc India Profiling
2007 Tidc India Profilingdanrinkes
油
The document discusses several advanced use cases for profiling applications using the XDS560 Trace tool and Advanced Event Triggering (AET) logic on Texas Instruments processors, including interrupt profiling to analyze interrupt servicing times, statistical profiling to identify functions consuming the most cycles, thread-aware profiling to generate a cycle-accurate execution graph of thread-based applications, and generating a thread-based dynamic call graph from captured trace data.An Optimized Parallel Algorithm for Longest Common Subsequence Using Openmp ...
An Optimized Parallel Algorithm for Longest Common Subsequence Using Openmp ...IRJET Journal
油
This document summarizes research on developing parallel algorithms to optimize solving the longest common subsequence (LCS) problem. LCS is commonly used for sequence comparison in bioinformatics. Traditional sequential dynamic programming algorithms have complexity of O(mn) for sequences of lengths m and n. The document reviews parallel algorithms developed using tools like OpenMP and GPUs like CUDA to reduce computation time. It proposes the authors' own optimized parallel algorithm for multi-core CPUs using OpenMP.Part10 finance investment limitations of ratio analysis
Part10 finance investment limitations of ratio analysisRamadan Babers, PhD
油
Ratios have limitations in analyzing business performance and financial position. Ratios are based on financial statements, so they inherit limitations such as the exclusion of certain assets from statements. Creative accounting can also mislead ratios, as companies may deliberately misrepresent financial health. Inflation distorts reported asset values and profit measurements in financial statements, hindering ratio comparisons over time. Relying only on ratios can overlook useful absolute information in statements. Differences between companies in accounting policies and other factors limit meaningful comparisons using ratios alone.Part09 finance investment ratio analysis investment ratio
Part09 finance investment ratio analysis investment ratioRamadan Babers, PhD
油
This document discusses various investment ratios used to assess company performance and stock value. It defines five key ratios: return on equity (ROE), earnings per share (EPS), price-earnings ratio (P/E), return on common equity (ROCE), and market to book ratio. For each ratio, it provides the calculation and explains how the ratio is used and what higher or lower values may indicate about the company's financials and stock price. Examples are given to demonstrate how to calculate ROE, EPS, and P/E using financial data from an example company's balance sheet and income statement.More Related Content
Similar to Python lec 1004_ch02_excercies (20)
rnaseq_from_babelomics
rnaseq_from_babelomicsFrancisco Garc
油
This document discusses RNA-Seq data analysis using Babelomics 5 software. It describes the typical RNA-Seq data analysis pipeline which includes sequence preprocessing, mapping, quantification, normalization, differential expression analysis, and functional profiling. It also discusses common file formats used like Fastq, BAM, and count matrices. Normalization methods like RPKM and TMM are explained. The document provides an overview of the RNA-Seq data analysis capabilities in Babelomics 5.An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...
An Efficient Biological Sequence Compression Technique Using LUT and Repeat ...IOSR Journals
油
This document presents two improved biological sequence compression algorithms that utilize a lookup table (LUT) and identification of tandem repeats in sequences. The first algorithm maps all possible 3-character combinations to ASCII characters using a 125-entry LUT. The second maps all possible 4-character combinations to ASCII characters using a 256-entry LUT. These algorithms aim to achieve high compression factors, saving percentages, and faster compression/decompression times compared to previous biological sequence compression methods.From DNA Sequence Variation to .NET Bits and Bobs
From DNA Sequence Variation to .NET Bits and BobsSource Conference
油
Mathieu Letourneau, Andrei Saygo, Eoin Ward, Microsoft
This talk will present our research project on .Net file clustering based on their respective basic blocks and the parallel that can be made with DNA sequence variation analysis. We implemented a system that extracts the basic blocks on each file and creates clusters based on them. We also developed an IDA plugin to make use of that data and speed up our analysis of .Net files.
Andrei Saygo, Eoin Ward and Mathieu Letourneau all work as Anti-Malware Security Engineers in the AM Scan team of Microsofts Product Release & Security Services group in Dublin, Ireland.
CCC-Bicluster Analysis for Time Series Gene Expression Data
CCC-Bicluster Analysis for Time Series Gene Expression DataIRJET Journal
油
The document presents a CCC-Biclustering (Contiguous Column Coherence) algorithm for identifying biclusters in time series gene expression data. The algorithm finds maximal biclusters with adjacent/contiguous columns in linear time using Ukkonen's suffix tree construction algorithm and discretized gene expression matrices. The algorithm was applied to a Saccharomyces cerevisiae gene expression time series in response to heat stress. It identifies coherent expression patterns shared among genes over contiguous time points, potentially revealing relevant regulatory modules.MuVM: Higher Order Mutation Analysis Virtual Machine for C
MuVM: Higher Order Mutation Analysis Virtual Machine for CSusumu Tokumoto
油
Mutation analysis is a method for evaluating the effectiveness of a test suite by seeding faults artificially and measuring the fraction of seeded faults detected by the test suite. The major limitation of mutation analysis is its lengthy execution time because it involves generating, compiling and running large numbers of mutated programs, called mutants. Our tool MuVM achieves a significant runtime improvement by performing higher order mutation analysis using four techniques, metamutation, mutation on virtual machine, higher order split-stream execution, and online adaptation technique. In order to obtain the same behavior as mutating the source code directly, metamutation preserves the mutation location information which may potentially be lost during bitcode compilation and optimization. Mutation on a virtual machine reduces the compilation and testing cost by compiling a program once and invoking a process once. Higher order split-stream execution also reduces the testing cost by executing common parts of the mutants together and splitting the execution at a seeded fault. Online adaptation technique reduces the number of generated mutants by omitting infeasible mutants. Our comparative experiments indicate that our tool is significantly superior to an existing tool, an existing technique (mutation schema generation), and no-split-stream execution in higher order mutation.DSP_Assign_1
DSP_Assign_1Joseph Chandler
油
This document summarizes four problems completed in a lab using a Tiva C Series microcontroller. Problem 1 introduced the microcontroller and Code Composer Studio software. Problem 2 described header files used in the code. Problem 3 explored adjusting clock speeds. Problem 4 provided an overview of the microcontroller platform, peripheral drivers library, and GPIO module. The code caused three LEDs to blink by writing pin values using delays timed based on clock speed.Towards reading genomic data using deep learning-driven NLP techniques
Towards reading genomic data using deep learning-driven NLP techniquesWesley De Neve
油
Towards reading genomic data using deep learning-driven NLP techniques. 際際滷s presented at BIOINFO 2016 Precision Bioinformatics & Machine Learning.1_chlamydia task completely best.docx
1_chlamydia task completely best.docxRachaelMutheu
油
This study sequenced and analyzed the genome of Chlamydia trachomatis. Quality control was performed on sequencing reads. The reads were then assembled using SPAdes and evaluated for quality. The assembled contigs were annotated using Prokka. Reads were aligned to the assembly using Bowtie2 and counted using HTSeq to quantify gene expression. Differential expression analysis was performed using DESeq2 to compare gene expression at different time points of infection. Various plots were generated to visualize the data.Pragmatic Optimization in Modern Programming - Demystifying the Compiler
Pragmatic Optimization in Modern Programming - Demystifying the CompilerMarina Kolpakova
油
This document discusses compiler optimizations. It begins with an outline of topics including compilation trajectory, intermediate languages, optimization levels, and optimization techniques. It then provides more details on each phase of compilation, how compilers use intermediate representations to perform optimizations, and specific optimizations like common subexpression elimination, constant propagation, and instruction scheduling.Gemoda
GemodaKyle Jensen
油
The document describes the Gemoda algorithm for discovering motifs (patterns) in biomolecular data sequences. Gemoda is designed to be exhaustive in finding all maximal motifs and have descriptive power by using a generic, context-dependent definition of similarity. It proceeds in three steps: comparison of all pairwise windows to create a similarity graph, clustering similar windows into elementary motifs, and convolving the motifs to find longer, maximal motifs. Gemoda can be applied to problems like discovering protein domains, solving motif discovery challenges, and finding conserved structures in protein structures.Comparative analysis of dynamic programming algorithms to find similarity in ...
Comparative analysis of dynamic programming algorithms to find similarity in ...eSAT Journals
油
Abstract There exist many computational methods for finding similarity in gene sequence, finding suitable methods that gives optimal similarity is difficult task. Objective of this project is to find an appropriate method to compute similarity in gene/protein sequence, both within the families and across the families. Many dynamic programming algorithms like Levenshtein edit distance; Longest Common Subsequence and Smith-waterman have used dynamic programming approach to find similarities between two sequences. But none of the method mentioned above have used real benchmark data sets. They have only used dynamic programming algorithms for synthetic data. We proposed a new method to compute similarity. The performance of the proposed algorithm is evaluated using number of data sets from various families, and similarity value is calculated both within the family and across the families. A comparative analysis and time complexity of the proposed method reveal that Smith-waterman approach is appropriate method when gene/protein sequence belongs to same family and Longest Common Subsequence is best suited when sequence belong to two different families. Keywords - Bioinformatics, Gene, Gene Sequencing, Edit distance, String Similarity.Comparative analysis of dynamic programming
Comparative analysis of dynamic programmingeSAT Publishing House
油
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology.Lossless Data Compression Using Rice Algorithm Based On Curve Fitting Technique
Lossless Data Compression Using Rice Algorithm Based On Curve Fitting TechniqueIRJET Journal
油
This document describes a lossless data compression technique called the Rice algorithm and a modification of the Rice algorithm using curve fitting. The Rice algorithm uses a two-stage approach of preprocessing data to decorrelate it followed by entropy coding to assign variable-length codes. The modified Rice algorithm uses curve fitting to generate a function to predict future data points for improved compression performance compared to the original Rice algorithm. Simulation results show the modified algorithm achieves better compression by selecting an encoding option that uses fewer bits than the original Rice algorithm on a sample data set.Gas leakage detection system
Gas leakage detection systemAashiq Ahamed N
油
The main aim of this project is to avoid the accident and death in the gas leakage explosion in house, hotels and industries. Domestically we use natural gas and it is very useful for burning purpose. If this gas is leaked in our kitchens, hotels or factories and not sensed in time, it may lead to fatal disaster, and may cause human and material loss. For this purpose we have developed GAS LEAKAGE DETECTION SYSTEM.
ECG BASED REPORT.
ECG BASED REPORT.Mehran University Of Engineering And Technology Jamshoro.
油
The document describes an algorithm for detecting R-peaks in an electrocardiogram (ECG) signal using MATLAB. It involves several steps: (1) removing low frequency components from the ECG signal using FFT, (2) finding local maxima using a windowed filter, (3) removing small values and storing significant peaks, (4) adjusting the filter size and repeating steps 2-3. The algorithm is demonstrated on two ECG data samples, showing the processed signal and detected peaks at each step. Finally, the document explains how to implement the algorithm in a neural network using the MATLAB Neural Network Toolbox.DNA Compression (Encoded using Huffman Encoding Method)
DNA Compression (Encoded using Huffman Encoding Method)Marwa Al-Rikaby
油
The document discusses DNA compression algorithms. It describes the common components of most DNA compression algorithms, which include finding repeat segments in a DNA sequence, considering approximate repeats allowing for operations like substitutions, and selecting the best set of compatible repeats. It then provides an example demonstrating how these steps may be applied to a sample DNA sequence to identify repeat segments and encode them for compression.BLAST_CSS2.ppt
BLAST_CSS2.pptSilpa87
油
This document provides an overview of the BLAST algorithm for calculating sequence similarity and its various outputs. BLAST (Basic Local Alignment Search Tool) finds local alignments between biological sequences and produces outputs in various formats including pairwise alignments, hit tables, and structured outputs like ASN.1 and XML. It works by creating a lookup table of words from the query and scanning the database for matches to initiate gapped or ungapped extensions. The document discusses strategies for improving BLAST throughput, such as using MegaBLAST for very similar sequences, increasing word size thresholds, and concatenating queries to minimize database scanning.2007 Tidc India Profiling
2007 Tidc India Profilingdanrinkes
油
The document discusses several advanced use cases for profiling applications using the XDS560 Trace tool and Advanced Event Triggering (AET) logic on Texas Instruments processors, including interrupt profiling to analyze interrupt servicing times, statistical profiling to identify functions consuming the most cycles, thread-aware profiling to generate a cycle-accurate execution graph of thread-based applications, and generating a thread-based dynamic call graph from captured trace data.An Optimized Parallel Algorithm for Longest Common Subsequence Using Openmp ...
An Optimized Parallel Algorithm for Longest Common Subsequence Using Openmp ...IRJET Journal
油
This document summarizes research on developing parallel algorithms to optimize solving the longest common subsequence (LCS) problem. LCS is commonly used for sequence comparison in bioinformatics. Traditional sequential dynamic programming algorithms have complexity of O(mn) for sequences of lengths m and n. The document reviews parallel algorithms developed using tools like OpenMP and GPUs like CUDA to reduce computation time. It proposes the authors' own optimized parallel algorithm for multi-core CPUs using OpenMP.More from Ramadan Babers, PhD (20)
Part10 finance investment limitations of ratio analysis
Part10 finance investment limitations of ratio analysisRamadan Babers, PhD
油
Ratios have limitations in analyzing business performance and financial position. Ratios are based on financial statements, so they inherit limitations such as the exclusion of certain assets from statements. Creative accounting can also mislead ratios, as companies may deliberately misrepresent financial health. Inflation distorts reported asset values and profit measurements in financial statements, hindering ratio comparisons over time. Relying only on ratios can overlook useful absolute information in statements. Differences between companies in accounting policies and other factors limit meaningful comparisons using ratios alone.Part09 finance investment ratio analysis investment ratio
Part09 finance investment ratio analysis investment ratioRamadan Babers, PhD
油
This document discusses various investment ratios used to assess company performance and stock value. It defines five key ratios: return on equity (ROE), earnings per share (EPS), price-earnings ratio (P/E), return on common equity (ROCE), and market to book ratio. For each ratio, it provides the calculation and explains how the ratio is used and what higher or lower values may indicate about the company's financials and stock price. Examples are given to demonstrate how to calculate ROE, EPS, and P/E using financial data from an example company's balance sheet and income statement.Part08 finance investment ratio analysis solvency ratio
Part08 finance investment ratio analysis solvency ratioRamadan Babers, PhD
油
This document discusses various solvency ratios that are used to measure a company's ability to meet its debt obligations. It defines four key ratios:
1) The equity ratio measures the percentage of total assets funded by shareholders' equity.
2) The debt-paying assets ability ratio indicates the percentage of total assets funded by creditors or debt.
3) The debt-paying equity ability ratio (debt-to-equity ratio) compares total liabilities to shareholders' equity to assess financial leverage.
4) The interest cover ratio compares earnings before interest and taxes (EBIT) to interest expenses to determine how easily a company can pay interest on outstanding debt.
Examples are provided to demonstratePart07 finance investment ratio analysis profitability ratio
Part07 finance investment ratio analysis profitability ratioRamadan Babers, PhD
油
This document discusses three profitability ratios: return on sales (ROS), operating margin, and return of investment (ROI). ROS measures net income as a percentage of net sales and indicates how much profit is generated from each dollar of sales. Operating margin measures operating income as a percentage of net sales to show profitability after variable costs. ROI measures net income as a percentage of total non-current assets and working capital to evaluate how effectively a company generates income from its invested capital. Examples are provided to demonstrate calculating each ratio using financial data from an income statement and balance sheet. Key points about interpreting each ratio are also summarized.Part06 finance investment ratio analysis efficiency ratio
Part06 finance investment ratio analysis efficiency ratioRamadan Babers, PhD
油
This document discusses various efficiency ratios used to assess how successfully a business manages its resources. It defines ratios such as accounts receivable turnover, days' sales outstanding, inventory turnover, inventory turnover in days, operating cycle, and asset turnover. Formulas for calculating each ratio are provided along with examples using figures from sample income statements and balance sheets. The ratios are used to measure elements like average time to collect payments, inventory holding periods, cash flow cycles, and efficiency of asset usage.Part05 finance investment_ratio_analysis_liquidity_ratio_presentation
Part05 finance investment_ratio_analysis_liquidity_ratio_presentationRamadan Babers, PhD
油
Liquidity ratios measure a company's ability to pay short-term debts. They include the current ratio, acid test ratio, and cash ratio. The current ratio compares current assets to current liabilities. The acid test ratio is similar but excludes inventories since they may not convert to cash quickly. The cash ratio considers only the most liquid assets like cash and marketable securities compared to current liabilities. These ratios are used to analyze a company's short-term financial health and liquidity.Part04 finance investment_ratio_analysis_introduction_presentation
Part04 finance investment_ratio_analysis_introduction_presentationRamadan Babers, PhD
油
This document provides an introduction to ratio analysis. It discusses how ratios can be used to compare a business's performance over time, to similar businesses, and to planned performance. It outlines different types of financial ratios including liquidity, efficiency, profitability, financial gearing/equity/solvency, and investment/share ratios. Examples of a balance sheet and income statement are also provided to demonstrate how key financial metrics are presented. The document concludes with information on asking questions.Part03 finance investment_financial_statement_analysis_presentation
Part03 finance investment_financial_statement_analysis_presentationRamadan Babers, PhD
油
Financial statement analysis is important for (1) projecting future earnings and cash flow, (2) evaluating a firm's flexibility, and (3) assessing management's performance. Financial statements are analyzed by both internal users like managers and external users like creditors and investors. Common methods of financial analysis include horizontal analysis, vertical analysis, trend percentages, and ratio analysis. These methods are used to evaluate a company's past performance, current financial position, and future profitability and solvency.Part02 finance investment_finance_and_financial_reporting_presentation
Part02 finance investment_finance_and_financial_reporting_presentationRamadan Babers, PhD
油
The document discusses various aspects of financial reporting. It begins by defining financial reporting as how companies show their financial performance to interested parties through financial statements. It then discusses the four main financial statements used in reporting: (1) the balance sheet, which reports a company's financial position at a point in time; (2) the income statement, which reports financial performance over a period of time; (3) the cash flow statement, which provides information beyond accrual accounting; and (4) the statement of changes in owners' equity, which reports changes in the equity section of the balance sheet. The document also provides details on the elements, purpose, and use of each financial statement type.Part01 finance investment_basics_presentation
Part01 finance investment_basics_presentationRamadan Babers, PhD
油
This document provides an introduction to finance and accounting concepts. It outlines the objectives of understanding key financial ratios, calculating ratios to assess business performance and predict failure, and discussing limitations of ratio analysis. It defines scarcity in economic terms. It also distinguishes between generally accepted accounting principles (GAAP) and international financial reporting standards (IFRS). Finally, it describes the basic accounting system including accounts, the chart of accounts, journal entries, the general ledger, trial balances, and adjusting entries.Strategic Management part_03_03
Strategic Management part_03_03Ramadan Babers, PhD
油
This document provides an overview of strategic management and the strategic planning process. It discusses establishing strategic direction through vision, mission, and identifying key performance areas. It covers developing business strategies, organizing strategy development, and gap analysis and objective setting. It then outlines the action planning process to align the organization to the strategy through communication and training. Finally, it discusses implementing the strategic plan, measuring and auditing results, and developing a continuous improvement process using the PDCA cycle.Strategic Management part_02_03
Strategic Management part_02_03Ramadan Babers, PhD
油
Sm 11 part_02_03
Strategic Management course version 11
Strategic management in any organization is important as it provides overall direction by developing plans and policies designed to achieve objectives and then allocating resources to implement the plans.
Video on YouTube:
video 01
https://youtu.be/alh6O6Q_9sc
video 02
https://youtu.be/b2UwGeOTEX0
video 03
https://youtu.be/R7K0W3yinLo
Strategic Management part_01_03
Strategic Management part_01_03Ramadan Babers, PhD
油
1. The document discusses strategic management and planning. It introduces strategic planning boards, different management levels, and models for strategic management.
2. Key aspects of strategic management covered include external and internal scanning, analyzing opportunities/threats and strengths/weaknesses, developing long-term objectives and strategies, and implementing, measuring, and evolving strategies.
3. Critical factors to consider in strategic management are the legal, economic, technological, customer, competitor, physical, political, and social environments that can impact an organization.Customer Experience (CX) updated version V9.0
Customer Experience (CX) updated version V9.0Ramadan Babers, PhD
油
CXCUSTOMER EXPERIENCE
The document discusses customer experience (CX) and its importance for businesses. It defines CX as a customer's holistic perception of their experience with a business or brand resulting from every interaction. A good CX is achieved through listening to customers, using feedback, and reducing friction. Measuring CX through metrics like Net Promoter Score and Customer Satisfaction Score allows businesses to analyze the CX and improve areas that create negative experiences for customers. The document outlines the CX cycle customers go through and how implementing a CX strategy can positively impact each stage of a customer's journey.Classification using decision tree in detail
Classification using decision tree in detailRamadan Babers, PhD
油
The document outlines the process of building decision trees for machine learning. It discusses key concepts like decision tree structure with root, internal and leaf nodes. It also explains entropy and information gain, which are measures of impurity/purity used to select the best attributes to split nodes on. The example of building a decision tree to predict playing tennis is used throughout to demonstrate these concepts in a step-by-step manner.Customer Experience (CX)
Customer Experience (CX)Ramadan Babers, PhD
油
Objectives:
1- introduction
2- Evolution of Marketing
3- CX Definition
4- Why is CX important for your business
5- The benefits of delivering a great CX
6- What is a good CX
7- The difference between CX & CS
8- The CX Cycle
9- Ways to Communicate your Customer
10- Measuring CX
11- Analyzing CXPython lec 1003_for_biologists
Python lec 1003_for_biologistsRamadan Babers, PhD
油
This document discusses various tools for manipulating strings in Python. It covers storing strings in variables, concatenating strings, finding the length of strings, changing case, replacing substrings, extracting substrings, and counting/finding substrings. Examples are provided for each tool to demonstrate how to manipulate and analyze string data like DNA sequences.Python lec 1002_for_biologists
Python lec 1002_for_biologistsRamadan Babers, PhD
油
This document provides an introduction to using Python for biologists. It discusses what Python is, gives examples of using it to calculate areas in flowcharts, and demonstrates how to print and manipulate text in Python. The document is divided into chapters that cover topics like why Python is suitable for biologists, printing messages, using quotes, comments, and error handling. Examples are provided throughout to illustrate concepts.Python lec 1001_for_biologists
Python lec 1001_for_biologistsRamadan Babers, PhD
油
This document provides an introduction to programming concepts for biologists using Python. It outlines topics including how programs work using compilers and interpreters to translate between programming languages and machine language. It discusses potential ambiguity in natural languages that require formal grammars for programming. Examples are provided of grammar rules and derivation of sentences from non-terminals. A quiz question asks which sentence could be derived from a given grammar.Db lec 08_new
Db lec 08_newRamadan Babers, PhD
油
The document discusses database indexing and different types of indexes. It defines indexing as optimizing database performance by minimizing disk accesses during queries. Primary indexes are defined on ordered data files ordered by a key field, usually the primary key. Secondary indexes can be on candidate keys or non-key fields. Indexes can also be clustered or ordered on non-key fields, and can be dense indexes with an entry for every search key, or sparse indexes with one entry per data block.Recently uploaded (20)
Test Bank Pharmacology 3rd Edition Brenner Stevens
Test Bank Pharmacology 3rd Edition Brenner Stevensevakimworwa38
油
Test Bank Pharmacology 3rd Edition Brenner Stevens
Test Bank Pharmacology 3rd Edition Brenner Stevens
Test Bank Pharmacology 3rd Edition Brenner Stevens"The Write Path: Navigating Research Writing, Publication, and Professional G...
"The Write Path: Navigating Research Writing, Publication, and Professional G...neelottama
油
To understand the meaning of publication
IB-Unit-5 BBA BVIMR 2022 Syllabus_watermark.pdf
IB-Unit-5 BBA BVIMR 2022 Syllabus_watermark.pdfDr. Mahtab Alam
油
International Business BBA as per CBCS 2022 Syllabus of Bharati Vidyapeeth (Deemed to be University)O SWEET SPONTANEOUS BY EDWARD ESTLIN CUMMINGSAN.pptx
O SWEET SPONTANEOUS BY EDWARD ESTLIN CUMMINGSAN.pptxLiterature Hero
油
O SWEET SPONTANEOUS
explain
Themes
Synthesis for VIth SEM 21-2-25.pptx by Mrs. Manjushri P. Dabhade
Synthesis for VIth SEM 21-2-25.pptx by Mrs. Manjushri P. DabhadeDabhade madam Dabhade
油
Synthesis of drugsIntroduction to Karnaugh Maps (K-Maps) for Simplifying Boolean Expressions
Introduction to Karnaugh Maps (K-Maps) for Simplifying Boolean ExpressionsGS Virdi
油
Presentation by Dr. G.S. Virdi: Explore the Karnaugh Map (K-Map) technique for simplifying and manipulating Boolean expressions. Dr. Virdi provides an in-depth look at why K-Maps are essential in digital design and how they can streamline logical operations for circuits of varying complexity.
Key Takeaways:
Learn the tabular structure of K-Maps and how to systematically group terms
Discover practical tips for reducing Boolean equations with a visual approach
Gain insights into designing more efficient, cost-effective digital systems
Target Audience: This presentation is ideal for electronics enthusiasts, students of digital logic, and seasoned professionals looking for a straightforward approach to Boolean simplification and circuit optimization.How to configure the retail shop in Odoo 17 Point of Sale
How to configure the retail shop in Odoo 17 Point of SaleCeline George
油
Odoo's Retail Shop is managed by the module Point of Sale(POS). It is a powerful tool designed to streamline and optimize the operations of retail businesses. It provides a comprehensive solution for managing various aspects of a retail store, from inventory and sales to customer management and reporting.
Combinatorial_Chemistry.pptx by Mrs. Manjushri P. Dabhade
Combinatorial_Chemistry.pptx by Mrs. Manjushri P. DabhadeDabhade madam Dabhade
油
Introduction to combinatorial chemistry 
Strategic Corporate Social Responsibility: Sustainable Value Creation Fourth
Strategic Corporate Social Responsibility: Sustainable Value Creation Fourthkeileyrazawi
油
Strategic Corporate Social Responsibility: Sustainable Value Creation Fourth
Strategic Corporate Social Responsibility: Sustainable Value Creation Fourth
Strategic Corporate Social Responsibility: Sustainable Value Creation FourthPushyabhuti Dynesty Vardhan Vamsha Early Rulers.pptx
Pushyabhuti Dynesty Vardhan Vamsha Early Rulers.pptxArya Mahila P. G. College, Banaras Hindu University, Varanasi, India.
油
Srikanth Bana describes a district named Srikanth in his Harshcharit. It included the modern Delhi and Haryana regions. This district was very prosperous and happy. But Hiuen Tsang criticizes the residents here. According to him, they were superstitious, narrow-minded and intolerant. It seems that non-Buddhist residents were in majority in Srikanth district. Hiuen Tsang has termed the religious beliefs of these residents as superstition, narrow-mindedness and intolerant.GenAI for Trading and Asset Management by Ernest Chan
GenAI for Trading and Asset Management by Ernest ChanQuantInsti
油
Presentation from the power-packed webinar on AI-driven trading and automation, bringing together leading experts and a community of over 6000 traders, analysts, developers, and students.
Participants got the chance to interact live with experts, ask questions, and gain practical, actionable skills in automated tradingmaking this webinar a useful resource for anyone serious about the future of trading technology.
In Session 1, renowned quant expert Dr. Ernest Chan explores the evolving role of Generative AI in finance, diving into advanced trading strategies that go beyond traditional language models (LLMs).
About the author:
Dr. Ernest P. Chan is a recognized expert in applying statistical models and machine learning to finance. He is the Founder and Chief Scientist at PredictNow.ai, where he helps investors make informed decisions using advanced data-driven insights. Additionally, he is the Founder and Non-executive Chairman of QTS Capital Management, LLC, which focuses on systematic trading strategies. Dr. Chan has worked at notable organizations like IBM Research, Morgan Stanley, and Credit Suisse, gaining experience in pattern recognition, data mining, and quantitative trading.
Dr. Chan obtained his PhD in Physics from Cornell University and his B.Sc. in Physics from the University of Toronto. He has also authored several influential books, including Quantitative Trading and Algorithmic Trading. He was an Adjunct Associate Professor of Finance at Nanyang Technological University in Singapore and an adjunct faculty at Northwestern Universitys Masters in Data Science program.
Dr. Chan combines extensive industry experience with deep technical knowledge, making him an excellent resource for understanding how to apply machine learning to trading effectively.
This webinar was conducted on: Thursday, April 10, 2025
BUSINESS QUIZ | THE QUIZ CLUB OF PSGCAS | 17TH MARCH 2025 .pptx
BUSINESS QUIZ | THE QUIZ CLUB OF PSGCAS | 17TH MARCH 2025 .pptxQuiz Club of PSG College of Arts & Science
油
The Quiz club of PSGCAS brings you another fun-filled trivia ride. Presenting you a Business quiz with 20 sharp questions to feed your intellectual stimulus. So, sharpen your business mind for this quiz set
Quizmaster: Thanvanth N A, BA Economics, The Quiz Club of PSG College of Arts & Science (2023-26 batch)10.socialorganisationandsocialsystem .pptx
10.socialorganisationandsocialsystem .pptxVivek Bhattji
油
SOCIAL ORGANIATION & SOCIAL DISORGANIZATION
APPLIED SOCIOLOGY nature and importance of Indian Knowledge System
nature and importance of Indian Knowledge Systemhanishabatra0
油
it depicts the nature and importance of Indian Knowledge systemUsing GenAI for Universal Design for Learning
Using GenAI for Universal Design for LearningDamian T. Gordon
油
Using GenAI for Universal Design for Learning Proteins, Bio similars & Antibodies.pptx
Proteins, Bio similars & Antibodies.pptxAshish Umale
油
The slides describe about the protein along with biosimilar data, which is helpful for the study respect to the subject. antibody is known to be active against antigen to show its action in treatment of various disease condition.
These slides gives you the information regarding the topic of protein, biosimilars and details about antibody in response to the antigen along with targeted drug to the antigen. As this topic data is useful for the students of sem VI who are studying in Bachelor of Pharmacy with respect to the subject Pharmacology III.Pushyabhuti Dynesty Vardhan Vamsha Early Rulers.pptx
Pushyabhuti Dynesty Vardhan Vamsha Early Rulers.pptxArya Mahila P. G. College, Banaras Hindu University, Varanasi, India.
油
BUSINESS QUIZ | THE QUIZ CLUB OF PSGCAS | 17TH MARCH 2025 .pptx
BUSINESS QUIZ | THE QUIZ CLUB OF PSGCAS | 17TH MARCH 2025 .pptxQuiz Club of PSG College of Arts & Science
油
Python lec 1004_ch02_excercies
- 1. + Dr. Ramadan Babers Faculty of Science - Helwan University Spring 2019 Python LEC - 03 for Biologists https://www.linkedin.com/in/ramadan-babers-phd-78976345
- 3. 3 1- Calculating AT content Here's a short DNA sequence: ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT Write a program that will print out the AT content of this DNA sequence. Hint: you can use normal mathematical symbols like add (+), subtract (-), multiply (*), divide (/) and parentheses to carry out calculations on numbers in Python.
- 4. 4 1- Calculating AT content
- 5. 5 1- Calculating AT content (Quiz) Here's a short DNA sequence: ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT Write a program that will print out the AT content of this DNA sequence. Hint: you can use normal mathematical symbols like add (+), subtract (-), multiply (*), divide (/) and parentheses to carry out calculations on numbers in Python. The result will be as shown below
- 6. 6 2- Complementing DNA Here's a short DNA sequence: ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT Write a program that will print the complement of this sequence. i.e., replace: A with T, T with A, C with G, and G with C.
- 8. 8 3- Restriction fragment lengths Here's a short DNA sequence: ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT The sequence contains a recognition site for the EcoRI restriction enzyme, which cuts at the motif G*AATTC (the position of the cut is indicated by an asterisk). Write a program which will calculate the size of the two fragments that will be produced when the DNA sequence is digested with EcoRI.
- 9. 9 3- Restriction fragment lengths
- 10. 10 3- Restriction fragment lengths (Quiz) Here's a short DNA sequence: ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT The sequence contains a recognition site for the EcoRI restriction enzyme, which cuts at the motif G*AATTC (the position of the cut is indicated by an asterisk). Write a program which will calculate the size of the two fragments that will be produced when the DNA sequence is digested with EcoRI. Print the DNA Print the DNA Length Print Fragment1 Print Fragment2 Print Fragment1 Length Print Fragment2 Length